panJacob antibody raised against a GST fusion protein (GST-Jacob-253–404), a rabbit anti- panJacob peptide antibody raised against the rat peptide sequence MKADTSHDSRDSSDLQ
ثبت نشده
چکیده
Genotyping. Genotypes were confirmed by standard PCR protocols using the following primers: F-Jac_5574 CTGAGGCTGAGACCTAGCGC; R-Jac_6032 CAGCCTCCAATACTGGCAAGAC; R-Jac_7329 GGAAGGGACTTCATCCTGACTG resulting in bands of 459 bp for wt and 187 bp for ko condition. PCRs were performed on tail biopsy after lysis in tail-cut buffer (10 mM Tris HCl pH 8.0, 100 mM NaCl containing Proteinase K at a final concentration of 0,4 mg/ml).
منابع مشابه
Production and Evaluation of Polyclonal Rabbit Anti-Human p53 Antibody Using Bacterially Expressed Glutathione S-transferase-p53 fusion protein
p53 is a key tumor suppressor gene that is targeted for inactivation during human tumorigenesis. In this study, we produced and characterized polyclonal antihuman p53 antibody. The cDNA encoding the completehuman p53 protein was cloned into pGEX-4T-1 and expressed in Escherichia coli as a fusion protein with Schistosoma japonicum glutathione S-transferase (GST). The rabbits were immunized...
متن کاملPeptide based polyclonal antibody production against bovine rotavirus non structure protein4 (NSP4)
The rotavirus nonstructural protein 4 (NSP4), is a multi functional protein that play key role in both viral morphogenesis and cytopathic effect associated with cell death. However, the complete biological effect of NSP4 remains to be clarified. Since to obtain further knowledge about this protein there is a need for recognizing antibody and there is no commercial antibody against this protein,...
متن کاملDesign and Construction of a Novel Humanized Single-Chain Variable-Fragment Antibody against the Tumor Necrosis Factor alpha
The pro-inflammatory cytokine, TNF-α, which plays a major role in the development and persistence of inflammatory diseases, is the basis for the use of anti-TNF-α therapies. The neutralization of TNF-α or blockage of its binding to the corresponding receptor has mainly served as a therapeutic strategy against some diseases. This study aimed to investigate the production of a humanized single ch...
متن کاملProduction and characterization of polyclonal antibody against a synthetic peptide from β-actin protein
Objective(s):Antibodies against actin, as one of the most widely studied structural and multifunctional housekeeping proteins in eukaryotic cells, are used as internal loading controls in western blot analyses. The aim of this study was to produce polyclonal antibody against a synthetic peptide derived from N-terminal region of β-actin protein to be used as a protein loading control in western ...
متن کاملDesign and Construction of a Novel Humanized Single-Chain Variable-Fragment Antibody against the Tumor Necrosis Factor alpha
The pro-inflammatory cytokine, TNF-α, which plays a major role in the development and persistence of inflammatory diseases, is the basis for the use of anti-TNF-α therapies. The neutralization of TNF-α or blockage of its binding to the corresponding receptor has mainly served as a therapeutic strategy against some diseases. This study aimed to investigate the production of a humanized single ch...
متن کامل